Bloghttp://paulech.blog.sme.sk/rssblog.sme.skblog@sme.sksk11. prikázanie: Nezobudíš puberťáka! (paulech)Dnes opäť o biorytmoch, o tom, prečo je také ťažké zobudiť násť-ročných školákov a prečo sú aj slepé oči dôležité. Fri, 03 Oct 2014 20:31:21 +0200http://paulech.blog.sme.sk/c/366119/11-prikazanie-nezobudis-pubertaka.html?ref=rssAko oscilujúce gény riadia náš biorytmus (paulech)Objavili sme oscilujúce gény, ktoré ovládajú biologické hodiny prakticky všetkých živých tvorov. Ľudí, kvetov, vínnych mušiek, mikróbov a mnohých iných. Podstatu ich fungovania a dôsledky porúch ešte len spoznávame. Fri, 19 Sep 2014 18:51:20 +0200http://paulech.blog.sme.sk/c/365112/ako-oscilujuce-geny-riadia-nas-biorytmus.html?ref=rssAko 100x prepísať Bibliu a zameniť len jediné písmeno (paulech)V každej z biliónov buniek nášho tela sa nachádzajú mikroskopickí „pisári“ schopní skopírovať milióny písmen predlohy bez jedinej chyby. Výkon pre človeka nemysliteľný. Ide však o DNA a tam sa aj najmenšia chybička môže niekedy kruto vypomstiť.  Fri, 05 Sep 2014 20:37:49 +0200http://paulech.blog.sme.sk/c/364297/ako-100x-prepisat-bibliu-a-zamenit-len-jedine-pismeno.html?ref=rssChutné a voňavé poruchy (paulech)Mnoho sme už hovorili o škodlivosti mutácií, teda porúch v DNA. Je čas pozrieť sa aj na situácie, keď nám prinášajú radosť, potešenie a pôžitok. Thu, 21 Aug 2014 19:43:08 +0200http://paulech.blog.sme.sk/c/363290/chutne-a-vonave-poruchy.html?ref=rssKľúče k našim génom (paulech)Vesmír našich buniek je úchvatný. Nielen podoba jednotlivých génov, ale aj pavučina ich vzájomných vzťahov a dômyselná regulácia génovej aktivity tvoria hmotný základ toho, čomu hovoríme život.  Thu, 14 Aug 2014 16:38:17 +0200http://paulech.blog.sme.sk/c/362959/kluce-k-nasim-genom.html?ref=rssO stretnutí s objaviteľom najslávnejšej kométy dneška (paulech)Vďaka sonde Rosetta bude v najbližšom čase svetovo najpopulárnejšou kométa 67P/Churyumov-Gerasimenko. Jedna fotka mi pripomenula stretnutie s jej objaviteľom. Wed, 06 Aug 2014 07:50:10 +0200http://paulech.blog.sme.sk/c/362382/o-stretnuti-s-objavitelom-najslavnejsej-komety-dneska.html?ref=rssGenetické origami: prepis a zostrih DNA (paulech)Kým sa z informácie v DNA stane hotové bielkovinové dielo zabudované v našich svaloch, ľadvinách, či mozgoch, prechádza dômyselným mechanizmom rozzipsovania, prepisu, zostrihania, prekladu a stáčania. Thu, 31 Jul 2014 17:58:47 +0200http://paulech.blog.sme.sk/c/361964/geneticke-origami-prepis-a-zostrih-dna.html?ref=rssCentrálna dogma: od DNA k pevným zadočkom (paulech)Vedeckí velikáni každej doby si musia pri medializácii svojich názorov dávať pozor na názvoslovie. Môže sa im stať, že dajú vzniknúť veľkej vedeckej myšlienke, ktorej názov bude mať celkom inú „príchuť“, ako pôvodne zamýšľali.  Thu, 24 Jul 2014 17:45:44 +0200http://paulech.blog.sme.sk/c/361514/centralna-dogma-od-dna-k-pevnym-zadockom.html?ref=rssFrédéric Chopin a chorý chlór (paulech)Čo vie genetika povedať o biednom zdraví slávneho skladateľa, ale aj tisícov ľudí s rovnakou diagnózou- cystickou fibrózou? Thu, 17 Jul 2014 18:42:39 +0200http://paulech.blog.sme.sk/c/361031/frederic-chopin-a-chory-chlor.html?ref=rssVďaka čomu bije srdce? (paulech)Aké chemické čary zodpovedajú za pravidelný tlkot ľudského srdca? A ako s tým súvisí adrenalín, za ktorým sa dnes často ženieme? Thu, 10 Jul 2014 18:42:08 +0200http://paulech.blog.sme.sk/c/360745/vdaka-comu-bije-srdce.html?ref=rssKokaín znásilňuje neuróny (paulech)Na miestach, kde na seba funkčne nadväzujú dva neuróny prebieha v zlomku sekundy očarujúci chemický koncert. Poznáme ho do najjemnejších detailov a môžeme sa ním kochať. No dá sa aj ľahko znásilniť a rozladiť pri hľadaní falošného drogového „šťastia“. Thu, 03 Jul 2014 18:42:15 +0200http://paulech.blog.sme.sk/c/360345/kokain-znasilnuje-neurony.html?ref=rssMexické vlny v neurónoch (paulech)Často počujeme pojmy ako „šírenie nervového vzruchu“ či „elektrická aktivita“ mozgu. Až detailný pohľad na povrch neurónu odhalí dych berúci biochemický orchester a neuveriteľné vrenie atómov, ktoré pre nás trpezlivo v zlomku sekundy zabezpečujú tieto pochody nevyhnutné pre život. Thu, 26 Jun 2014 18:42:46 +0200http://paulech.blog.sme.sk/c/359896/mexicke-vlny-v-neuronoch.html?ref=rssBunky v trvalom napätí (paulech)Prakticky všetky mnohobunkové organizmy si na povrchu každej z biliónov buniek udržujú určité elektrické napätie. Aby to dokázali, sú vyzbrojené molekulárnymi pumpami a kanálmi. Ich poruchy majú na svedomí ochorenia ako srdcová arytmia, či epilepsia.  Thu, 19 Jun 2014 18:42:18 +0200http://paulech.blog.sme.sk/c/359367/bunky-v-trvalom-napati.html?ref=rssSlzy, krv, pot a pivo (paulech)Bez Akvaporínov, špeciálnych kanálov slúžiacich bunke na reguláciu vody, by dôležité orgány nášho tela nefungovali. Prišli by sme nielen o schopnosť roniť slzy, ale aj o primeraný obsah vody v iných telesných tekutínách, ako krv, sliny, žlč, pot, či moč. Akvaporíny tiež detailne vysvetľujú, prečo po pive musíme často behať na WC. Preto nás neprekvapí, že za ich objav bola v roku 2003 udelená Nobelova cena. Thu, 12 Jun 2014 19:36:04 +0200http://paulech.blog.sme.sk/c/358868/slzy-krv-pot-a-pivo.html?ref=rssParkinson, Alzheimer a bunkové gardedámy (paulech)Bielkoviny sú objemnou a funkčne najdôležitejšou zložkou ľudského tela. Ich výroba z DNA a následné poskladanie do správneho tvaru sú pre prežitie organizmu zásadné, lebo poruchy tohto procesu vedú často k veľmi závažným ochoreniam. Nečudo, že v bunkách máme drobučké "gardedámy" - Chaperóny – ktoré dozorujú a regulujú správnu výrobu aj zánik bielkovín. A z čoho sú zložené? Predsa tiež z bielkovín! Thu, 05 Jun 2014 18:50:52 +0200http://paulech.blog.sme.sk/c/358401/parkinson-alzheimer-a-bunkove-gardedamy.html?ref=rssKráčajúce molekuly (paulech)Kráčanie na dvoch nohách považujeme za symbol ľudskosti. Koho by napadlo, že po bunkovom lešení sú schopné robiť krok za krokom nemysliace molekuly v každej z biliónov našich buniek. Za sebou pritom vlečú na presne určené miesto zmätkom bunkového veľkomesta gigantický náklad. Bez ich práce je zakrátko po nás.Thu, 29 May 2014 18:17:22 +0200http://paulech.blog.sme.sk/c/357716/kracajuce-molekuly.html?ref=rssNovorodencov zohrieva skrat v mitochondriách (paulech)Keď príde bábätko na svet, je bezbranné voči nástrahám okolitého prostredia. Okrem iného ho môže trápiť aj chlad. Kým sa naučí vyrábať si teplo svalmi, má vo svojom telíčku dômyselný systém tvorby tepla – hnedý tuk. Teplo v ňom vzniká ozaj čudesným spôsobom – skratovaním mitochondrií. Thu, 22 May 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/357019/novorodencov-zohrieva-skrat-v-mitochondriach.html?ref=rssPod ochranou červených kosákov (paulech)Vybrať si medzi anémiou a maláriou, to by bola ťažká voľba. Najlepšie je pochopiteľne vyhnúť sa obom naraz. Na pomoc môže prísť neočakávaný spojenec – škodlivý gén spôsobujúci kosákovitú deformáciu červených krviniek.  Thu, 15 May 2014 15:59:13 +0200http://paulech.blog.sme.sk/c/355996/pod-ochranou-cervenych-kosakov.html?ref=rssTolerantní zlodeji mlieka (paulech)Je to už pár tisíc rokov, čo začal človek experimentovať s konzumáciou mlieka od domestikovaného dobytka. Stali sa z nás celoživotné dojčatá kradnúce materské mlieko iným živočíšnym druhom. Schopnosť tolerovať a stráviť v dospelosti mliečny cukor (Laktózu) vznikla vďaka drobným mutáciám konkrétnych génov a umožnila populáciám, hlavne tej našej, európskej, dostať sa k výdatnému zdroju živín. Intolerantná je ale ešte stále polovica ľudstva.Thu, 08 May 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/355524/Tolerantni-zlodeji-mlieka.html?ref=rssPrečo šváby nemajú kolesá (paulech)Napadlo vás niekedy, prečo príroda nevynašla koleso? My, ľudia, ho považujeme za obrovský míľnik v dejinách, čo prežil tisícročia až dodnes. Nikde v živej prírode sa ale nevyskytuje.Thu, 01 May 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/355064/Preco-svaby-nemaju-kolesa.html?ref=rssJacobsonov orgán a chémia milencov (paulech)Keď sa povie, že medzi milencami funguje nejaká chémia, nie je to len taká vzletná fráza. Môže to byť doslovná pravda. Na rozpoznávanie samičiek a iných užitočných informácií máme Jacobsonov orgán. Ak vám predstavivosť bludi ktovie kde - je v nose! Žiaľ, nefunguje nám už tak dobre, ako za dávnych čias. Thu, 24 Apr 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/354157/jacobsonov-organ-a-chemia-milencov.html?ref=rssBlúdivý nerv žirafy (paulech)Sledovaním tej krásy okolo nás, rozmanitosti adaptácií, tvarov a schopností živých tvorov môžeme ľahko nadobudnúť dojem, že evolúcia postupuje vždy optimálnym spôsobom, smerom k dokonalosti. Ale tak to nie je. Žirafy o tom vedia svoje ...Thu, 17 Apr 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/353655/Bludivy-nerv-zirafy.html?ref=rssStehno veľryby (paulech)Dnes si uvaríme evolučný guláš. Potrebujeme: kus stehna z veľryby, žĺtko ľudského embrya, panvu hada a oko jaskynnej ryby. Jedlé to asi nebude, ale pravdivé áno.Thu, 10 Apr 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/353586/Stehno-velryby.html?ref=rssAntibiotiká: Evolúcia v našich rukách (paulech)Viete čo má spoločné čivava so stafylokokom? Oba organizmy si prešli ľudským šľachtením. Psy sme si vyšľachtili celkom úmyselne a cielene na najrôznejšie účely od záchranárstva po nosenie v kabelkách. Baktérie, ako je Stafylokok, si naopak šľachtíme neúmyselne a nechtiac - užívaním širokospektrálnych antibiotík. Evolúciu týchto organizmov vidíme prebiehať priamo pred našimi zrakmi. Umelo sme ju urýchlili natoľko, že väčšina psov už dávno nepripomína vlka a antibiotiká účinkujú stále menej.Thu, 03 Apr 2014 18:42:42 +0200http://paulech.blog.sme.sk/c/353109/Antibiotika-Evolucia-v-nasich-rukach.html?ref=rssPopravená kráľovná a dieťa troch rodičov (paulech)Anglický kráľ Henrich VIII. dal popraviť kráľovnú-manželku, lebo mu nedokázala porodiť syna napriek tomu, že si kvôli nej musel vytvoriť vlastnú cirkev. Po takmer 500 rokoch sa témy aj znalosti ostrovanov zmenili. Parlament diskutuje o možnosti povoliť v Británii, ako v prvej krajine na svete, matkám s poruchami mitochondrií mať zdravé dieťa aj za cenu, že bude mať geneticky troch rodičov.Thu, 27 Mar 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/352465/Popravena-kralovna-a-dieta-troch-rodicov.html?ref=rssKvantová mechanika dýchania (paulech)Jednotná mena je veľmi starý vynález. Bola tu už v čase, keď neexistovala EÚ, ba ani kontinent, ktorý by sa mohol volať Európa. Všetko živé na planéte Zem zdieľa už stovky miliónov rokov spoločnú energetickú menu. Volá sa ATP. To, čomu hovoríme dýchanie, je v skutočnosti spôsob, akým si telo túto menu vyrába. Takéto molekulárne „bitcoiny“ generujú v našich bunkách mitochondrie a robia to skutočne úžasným spôsobom.Thu, 20 Mar 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/351761/Kvantova-mechanika-dychania.html?ref=rssUväznená mitochondria a zrod komplexného života (paulech)Prvé tri miliardy rokov vládli biosfére Zeme jednobunkové baktérie. Nesmierny, nepredstaviteľný čas. Bolo by to tak asi dodnes, keby mitochondrie neobetovali svoju slobodu a nepomohli vytvoriť nový typ buniek - základ mnohobunkového života. Dodnes stovky mitochondrií, kedysi nezávislých organizmov, nosíme v každej jednej bunke tela.Thu, 13 Mar 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/351172/Uvaznena-mitochondria-a-zrod-komplexneho-zivota.html?ref=rssGenetika šípkového čaju alebo ako sme prišli o Vitamín C (paulech)Náš evolučný predok stratil jeden podstatný gén, a preto si ľudské telo nedokáže vytvoriť extrémne dôležitý vitamín C. Takmer všetky ostatné rastliny a živočíchy to dokážu. Thu, 06 Mar 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/350687/genetika-sipkoveho-caju-alebo-ako-sme-prisli-o-vitamin-c.html?ref=rssMy sme Áčka, Američania sú nuly (paulech)Nie, neľakajte sa, nevrhol som sa na politické témy, aj keď naokolo zúri prezidentská kampaň. Chcem písať o genetike krvi a zmieniť aj to, že Americký svetadiel úplne ovláda krvná skupina nula, kým Európania majú často krv A. Ja osobne som B Rh negatív. A vy ste čo ráčili zdediť?Thu, 27 Feb 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/350021/My-sme-Acka-Americania-su-nuly.html?ref=rssZo života krvi (paulech)Porekadlo hovorí, že krv nie je voda. Biológia hovorí, že je to z polovice voda. Tá druhá polovica je biochemický zázrak, ktorý nás udržuje pri živote. Nazrime do jej súkromia.Thu, 20 Feb 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/349482/Zo-zivota-krvi.html?ref=rssMutanty na našich tanieroch (paulech)Banány, jahody, hrozno, melóny, reďkovky, papriky a podobné ovocie či zelenina sú na pultoch obchodov až absurdne veľké, ale zároveň im chýba výrazná chuť a vôňa. Viete prečo? Thu, 13 Feb 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/346120/mutanty-na-nasich-tanieroch.html?ref=rssMozaiky, mutácie a ľudské srdce (paulech)Slovo mutácia získalo zrejme vďaka obrazotvornosti Hollywoodu čudnú príchuť niečoho načisto nenormálneho. Ale nie je to tak. Mutácie sú jednoducho zmeny v sekvencií báz (písmen) DNA v našich bunkách a všetci ich v tele určite máme. Väčšinu si nikdy nevšimneme, ojedinele nám pomáhajú a niektoré nás ničia ťažkými chorobami. Keď to vezmeme ad absurdum, všetci sme mutanti.Thu, 06 Feb 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/348242/Mozaiky-mutacie-a-ludske-srdce.html?ref=rssChiméry: dva genómy v jednom tele (paulech)Jedno dieťatko počas tehotenstva je pre ženu štandard. Niekedy na svet vykuknú dvojičky, či trojičky. Tie, ako vieme, môžu byť celkom na nerozoznanie alebo aj úplne odlišné. Tým sa ale tvorivosť prírody zďaleka nekončí. Genetický chimérizmus - zriedkavý a kuriózny jav po oplodnení si popíšeme v tomto článku.Thu, 30 Jan 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/347531/Chimery-dva-genomy-v-jednom-tele.html?ref=rssChlapec, ktorého krv nemá otca (paulech)Každá bunka nášho tela obsahuje rovnakú DNA. Jedna polovica dedičnej informácie pochádza od otca a druhá od mamy. Chlapec, o ktorom budeme hovoriť, má ale v bunkách rôznych orgánov rôznu DNA. Kým napríklad v koži má gény od oboch rodičov, DNA v krvi pochádza iba od mamy. Spôsob oplodnenia, z akého sa tento chlapec zrodil bol zatiaľ zdokumentovaný iba jediný raz. Chcem vám o ňom, ale aj o procese „samooplodnenia“ ľudského vajíčka povedať viac.Thu, 23 Jan 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/347046/Chlapec-ktoreho-krv-nema-otca.html?ref=rssMaternicu mamy a placentu jej dieťaťa spojil vírus (paulech)Vírusy sú považované za hnusné malé mrchy, kvôli ktorým si míňame dovolenku a sponzorujeme výrobcov vreckoviek, čaju, citrónov a liekov. Málokedy nám ale napadne poďakovať sa im za svoju vlastnú existenciu, keďže výrazne prispeli k tomu, že ľudská placenta je taká skvelá vecička...Thu, 16 Jan 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/346092/Maternicu-mamy-a-placentu-jej-dietata-spojil-virus.html?ref=rssKam vedie pupok? (paulech)Obsluhuje nás kľúčových prvých deväť mesiacov nášho života a my mu nevenujeme počas ďalších desaťročí ani myšlienku.Nevďačníci! Čiastočné odpustky budú udelené za prečítanie tohto článku o súvise našich pupkov s novou metódou genetického vyšetrenia v tehotenstve, ktorá zaručene zistí pohlavie, odhalí genetické poruchy (ako Downov syndróm) a pošle amniocentézu na smetisko dejín....Thu, 09 Jan 2014 18:42:42 +0100http://paulech.blog.sme.sk/c/344713/Kam-vedie-pupok.html?ref=rssŠípová Ruženka vs Downov syndróm (paulech)Krátka, ale pravdivá rozprávka o tom, ako ženské vajíčka začnú vznikať ešte v embryu, potom sú dlhé predlhé roky začarované, až ich pekne po jednom prebudí a dokončí ovulácia. Aj táto rozprávka obsahuje ponaučenie do života. Je však smutné a varovné. Pre odkladanie tehotenstva za ostatných 15 rokov vzrástol výskyt Downovho syndrómu o 45%.Thu, 02 Jan 2014 18:02:51 +0100http://paulech.blog.sme.sk/c/345238/Sipova-Ruzenka-vs-Downov-syndrom.html?ref=rssHádanky v ľudskom genóme (paulech)Píše sa to XXX, je to o pohlaví, ale nesúvisí to s pornografiou. Čo je to?   Odpoveď: Je to genetická porucha - „trojitosť“ pohlavného chromozómu X u ženy. No a na sklade mám aj zaklínadlá ako X0, XXY, XXXX a ďalšie. Život s týmito poruchami v bunkách môže mať rôzne podoby. Niektoré ukončia takmer okamžite vývoj plodu potratom a iné si nevšimnete na manželke ani do Zlatej svadby.Fri, 27 Dec 2013 08:43:19 +0100http://paulech.blog.sme.sk/c/344739/Hadanky-v-ludskom-genome.html?ref=rssChlapské bradavky a Homunkulus (paulech)Na rozdiel od nežného pohlavia, kde je estetická aj praktická funkcia bradaviek na prsiach naskutku zjavná, u mužov je to úplná zbytočnosť. A to všetko preto, lebo na úplnom začiatku sme všetci dievčatá. Thu, 19 Dec 2013 18:23:21 +0100http://paulech.blog.sme.sk/c/344331/chlapske-bradavky-a-homunkulus.html?ref=rssY chromozóm a Džingischán (paulech)Ženy majú v každej bunke pár pohlavných chromozómov XX a muži XY. Muži síce vďaka svojmu Y môžu zistiť, či sú príbuzní Džingischána, no ženy sú vďaka dvom X oveľa lepšie chránené pred niektorými ťažkými chorobami. S tým už nič nenarobíme, ale je zaujímavé vedieť prečo to tak je...Wed, 11 Dec 2013 18:35:08 +0100http://paulech.blog.sme.sk/c/344288/Y-chromozom-a-Dzingischan.html?ref=rssO fľakatých ženách a vypínaní chromozómov (paulech)Molekulárna biológia a genetika prinášajú zázraky, ktorých skutočnosť nemusí posudzovať ani schvaľovať žiadna komisia. Sú prítomné v každej bunke našich tiel, iba sme ich doteraz nevideli. Napríklad toto: všetky cicavčie samice, vrátane našich partneriek, majú v každej bunke vypnutý náhodne vybraný jeden z dvojice pohlavných X chromozómov – sú teda trocha „fľakaté“.Wed, 04 Dec 2013 18:21:19 +0100http://paulech.blog.sme.sk/c/343879/O-flakatych-zenach-a-vypinani-chromozomov.html?ref=rssChcem, teda som. (paulech)Ako sa len zhovievavo uškŕňame nad obrazom polonahých indiánov, ktorých si dobyvatelia kúpili za pár sklíčok, zrkadielok a iných čačiek. Výmenou za to dostali nielen ich zlato, ale onedlho aj ich životy. Toto nebude o Amerike. Bude to o nás. Za pár generácii sme sa zmenili z ľudí na stroje konzumu a mediálneho blúznenia. Imperatív propagandy je všadeprítomný.Mon, 07 Oct 2013 18:05:01 +0200http://paulech.blog.sme.sk/c/339129/Chcem-teda-som.html?ref=rssŽivot na križovatke (paulech)Človek sa neraz ocitá v živote na pomyselných krížnych cestách. O tom ale vôbec písať nebudem. Mám na mysli skutočné križovatky a skutočných ľudí, ktorí na nich vo veľkých mestách žijú. Trávia dni nedôstojných žobraním stavajúc nás, motoristov, do morálnej dilemy. Pre nich je to: "Byť, či nebyť?" Pre nás iba: "Dať, či nedať?"Tue, 16 Oct 2012 17:41:14 +0200http://paulech.blog.sme.sk/c/310746/Zivot-na-krizovatke.html?ref=rssTelevízor je mŕtvy. Nech žije detstvo! (paulech)Konaj nekonaním a nič nezostane nevykonané. Táto taoistická formulka, ktorá sa zdá na prvý pohľad nezmyselná, sa mi v mysli vynorí vždy keď mi v živote zafunguje. Dlho som sa trápil tým, že sa deti snažia stráviť každú voľnú chvíľu v hypnóze obrazovky pred neuveriteľne stupídnymi programami a reklamami. Až sa to vyriešilo náhle a celkom samo. Nekonaním.Tue, 02 Oct 2012 19:09:25 +0200http://paulech.blog.sme.sk/c/309439/Televizor-je-mrtvy-Nech-zije-detstvo.html?ref=rssGlogláčik a hroznáda! (paulech)Včera večer mi pred spaním staršia dcérenka rozprávala, ktorí chalani sa jej v triede páčia. Z toho usudzujem, že onedlho, keď do podobného štádia dospeje aj jej menšia sestra, zbierku našich milých detských skomolenín už nerozšírime. Zatiaľ však stále máme z čoho vyberať....Fri, 04 Nov 2011 17:20:00 +0100http://paulech.blog.sme.sk/c/279756/Gloglacik-a-hroznada.html?ref=rssTrackujte tento message! (paulech)Nejaký kúsok našej genetickej výbavy (bude to niečo ako AGCTCAGGTACTAGAATCAGAA ATAGCGGGATACCATACGGAC…) má na svedomí, že sa potrebujeme neustále škatuľkovať, inými slovami patriť do konkrétnej komunity. Tá si okrem cieľov a triedneho nepriateľa zákonite vytvára aj svoj vlastný jazyk. Podľa možnosti taký, aby mu iné skupiny nerozumeli. Tým sa vytvára pocit príslušnosti a dôležitosti. Príklad č. 1: IT management.Thu, 18 Jun 2009 08:18:56 +0200http://paulech.blog.sme.sk/c/197201/Trackujte-tento-message.html?ref=rssFCB - Domy na úrovni doby (paulech)Niet horšieho nepriateľa, ako je nepriateľ neviditeľný. Ako nepriateľ, ktorého považujete za pomocníka a vpustíte si ho do domu. Na prelome tisícročí v naivnom konzume technológií ľudia hľadeli na funkčnosť, nie na následky. Keď boli konečne po desaťročiach zverejnené dlhodobé zdravotné štatistiky, mnoho ľudí sa poučilo. Dnes si už iba hazardér postaví dom bez FCB .Thu, 11 Jun 2009 15:01:14 +0200http://paulech.blog.sme.sk/c/188032/FCB-Domy-na-urovni-doby.html?ref=rssČo sme (ne)postavili (paulech)„Tati? A našu škôlku kto postavil?“ pýta sa dcérenka.„To takí šikovní ujovia, ako bol Tvoj dedko, vieš?“  odpovedám.  Malý štupel spracováva informáciu a úplne vidím, ako sa jej pod copmi rodí sprška náväzných otázok. Dúfam, že sa ma už v piatich rokoch neopýta, čo postavila moja generácia.Mon, 25 May 2009 18:10:26 +0200http://paulech.blog.sme.sk/c/188031/Co-sme-nepostavili.html?ref=rssČierna skrinka (paulech)Nech ste ktokoľvek, ak čítate tieto riadky, znamená to, že bol konečne vykopaný aj disk so zálohami servra sme.sk z roku 2009. Vaša éra mi dá istotne za pravdu. Dúfam, že moji prapravnuci sa živia ako sa patrí - dolovaním odpadkov.Tue, 31 Mar 2009 17:35:51 +0200http://paulech.blog.sme.sk/c/188028/Cierna-skrinka.html?ref=rssČísmenká (paulech)Nechutne rýchlo starneme a už bezmála dva roky som nedoplnil kolekciu hovadín, ktoré naše deti trúsia na bezstarostnej jazde životom.Thu, 26 Mar 2009 17:02:40 +0100http://paulech.blog.sme.sk/c/188025/Cismenka.html?ref=rssLiečba v čakárni (paulech)Vykračujem si rezkým krokom do práce a zrazu prásk. Ležím na zemi. Vydávam neartikulované zvuky a vzlyky, notebook sa váľa v prachu cesty. Ľavý členok opustil bez vyzvania svoje miesto. Šok, nadávky, zbieranie vecí, cesta autom takmer bez spojky, chirurgia. Vyliečil som sa však neočakávane už v čakárni.Sat, 20 Oct 2007 18:04:47 +0200http://paulech.blog.sme.sk/c/116975/Liecba-v-cakarni.html?ref=rss